ID: 971543394_971543400

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 971543394 971543400
Species Human (GRCh38) Human (GRCh38)
Location 4:27851651-27851673 4:27851690-27851712
Sequence CCTAATCTACGTCTAAAAGCCTC CTGCATTCCATTGGCAAAACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!