ID: 971546396_971546407

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 971546396 971546407
Species Human (GRCh38) Human (GRCh38)
Location 4:27891885-27891907 4:27891929-27891951
Sequence CCCAAATCTTATCTTGAATTGTT CATCAGAGGGACTCAGTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 106, 3: 823, 4: 1859}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!