ID: 971721920_971721928

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 971721920 971721928
Species Human (GRCh38) Human (GRCh38)
Location 4:30255917-30255939 4:30255938-30255960
Sequence CCAGACACAAGTACTAGCACCAG AGCTCTGATGGGGATGGCAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 12, 2: 40, 3: 107, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!