ID: 971735134_971735140

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 971735134 971735140
Species Human (GRCh38) Human (GRCh38)
Location 4:30439504-30439526 4:30439530-30439552
Sequence CCCTAAGACAGAAATAGAAATCA GAAGATTGGTGGTGGAGTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 45, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!