ID: 971735135_971735137

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 971735135 971735137
Species Human (GRCh38) Human (GRCh38)
Location 4:30439505-30439527 4:30439519-30439541
Sequence CCTAAGACAGAAATAGAAATCAG AGAAATCAGCAGAAGATTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 556} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!