ID: 971761883_971761889

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 971761883 971761889
Species Human (GRCh38) Human (GRCh38)
Location 4:30776607-30776629 4:30776658-30776680
Sequence CCTTCCTGAGACCGTTTCTTCAG AAAAAATGTATCACGAGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!