ID: 971763354_971763362

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 971763354 971763362
Species Human (GRCh38) Human (GRCh38)
Location 4:30798037-30798059 4:30798089-30798111
Sequence CCAAGATAAATGTGTTACCCATA GGCTCTAGTGGAGGACAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!