ID: 971764677_971764684

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 971764677 971764684
Species Human (GRCh38) Human (GRCh38)
Location 4:30815236-30815258 4:30815274-30815296
Sequence CCATATGGGTCTGCAACAACTGG GAGGAAATAATTAGGCTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 206} {0: 1, 1: 0, 2: 11, 3: 91, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!