ID: 971765566_971765571

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 971765566 971765571
Species Human (GRCh38) Human (GRCh38)
Location 4:30826433-30826455 4:30826466-30826488
Sequence CCACCCTCGGTCCAACTGAGTCT TAGTATATTAGAAGCCATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 193} {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!