ID: 971773899_971773901

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 971773899 971773901
Species Human (GRCh38) Human (GRCh38)
Location 4:30934841-30934863 4:30934874-30934896
Sequence CCAGATATCTTGGGTTCTAGTTC ACATTTCCAGAAAGAGAACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!