ID: 971817329_971817337

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 971817329 971817337
Species Human (GRCh38) Human (GRCh38)
Location 4:31505865-31505887 4:31505885-31505907
Sequence CCAGCCACCCTGTCACAGCCCAA CAATGGGCCTATGAACAAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!