ID: 971820041_971820050

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 971820041 971820050
Species Human (GRCh38) Human (GRCh38)
Location 4:31539902-31539924 4:31539943-31539965
Sequence CCAGTGTCATTCTTTCTCACAGT GTTAGATCCAAGGCTTGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!