ID: 971884929_971884935

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 971884929 971884935
Species Human (GRCh38) Human (GRCh38)
Location 4:32432236-32432258 4:32432262-32432284
Sequence CCCTTGGAATGTTGTGACCAGCG CAGGAACACCTCAGCCATACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 50, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!