ID: 971938972_971938988

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 971938972 971938988
Species Human (GRCh38) Human (GRCh38)
Location 4:33189414-33189436 4:33189457-33189479
Sequence CCACCAGCAGGTGTCACAGGCCA AGGGTGGTGGGCTACAGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 30, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!