ID: 971979292_971979298

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 971979292 971979298
Species Human (GRCh38) Human (GRCh38)
Location 4:33732858-33732880 4:33732903-33732925
Sequence CCAAAGCCCAATAGCAGGCCAAG AGTTACCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 7, 1: 198, 2: 182, 3: 122, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!