ID: 972045962_972045970

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 972045962 972045970
Species Human (GRCh38) Human (GRCh38)
Location 4:34664543-34664565 4:34664576-34664598
Sequence CCTTTCCCCAATCAGACAGTATA TTGTGTCTGAATTTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 152} {0: 1, 1: 1, 2: 5, 3: 33, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!