ID: 972067009_972067011

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 972067009 972067011
Species Human (GRCh38) Human (GRCh38)
Location 4:34960218-34960240 4:34960238-34960260
Sequence CCAACCTGAGAGACTATTGAGAC GACATGTAAAATGCAACTTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!