ID: 972067990_972067999

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 972067990 972067999
Species Human (GRCh38) Human (GRCh38)
Location 4:34976136-34976158 4:34976184-34976206
Sequence CCCAAACAGATTGAAGACACTGT ATGGAAATGGAGACTGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 73, 4: 719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!