ID: 972095489_972095496

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 972095489 972095496
Species Human (GRCh38) Human (GRCh38)
Location 4:35342660-35342682 4:35342704-35342726
Sequence CCCTGCCGTCTTCTGCAAGTAAC CTTGGCCTGTTACTGGGCTTTGG
Strand - +
Off-target summary No data {0: 169, 1: 171, 2: 103, 3: 76, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!