ID: 972095491_972095495

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 972095491 972095495
Species Human (GRCh38) Human (GRCh38)
Location 4:35342665-35342687 4:35342698-35342720
Sequence CCGTCTTCTGCAAGTAACTCTTC AATGCTCTTGGCCTGTTACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!