ID: 972218076_972218080

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 972218076 972218080
Species Human (GRCh38) Human (GRCh38)
Location 4:36919785-36919807 4:36919828-36919850
Sequence CCCTCAGTTTCATTTCCATCATT AAGTGTCTCTTTAATGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 576} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!