ID: 972251580_972251592

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 972251580 972251592
Species Human (GRCh38) Human (GRCh38)
Location 4:37308513-37308535 4:37308554-37308576
Sequence CCATTAGTGGCAGGAGCAGACCC GGTCCCTGGGGAGCATGCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 127} {0: 1, 1: 0, 2: 5, 3: 21, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!