ID: 972274147_972274150

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 972274147 972274150
Species Human (GRCh38) Human (GRCh38)
Location 4:37541409-37541431 4:37541435-37541457
Sequence CCTATTAGAGGTACTTAAGTCTT ACAATGATAGACCCTTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125} {0: 1, 1: 0, 2: 1, 3: 6, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!