ID: 972289089_972289092

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 972289089 972289092
Species Human (GRCh38) Human (GRCh38)
Location 4:37674456-37674478 4:37674483-37674505
Sequence CCTTTTTCTTTTGGTGGTTGTTC TTTTGCCTTTAGAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 591} {0: 1, 1: 0, 2: 4, 3: 41, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!