ID: 972318287_972318293

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 972318287 972318293
Species Human (GRCh38) Human (GRCh38)
Location 4:37948189-37948211 4:37948207-37948229
Sequence CCATGTCAGAGGAGCAGCAAGGC AAGGCGGACTGGAGGGCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!