ID: 972324883_972324889

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 972324883 972324889
Species Human (GRCh38) Human (GRCh38)
Location 4:38006027-38006049 4:38006045-38006067
Sequence CCTTTCTCATTTTACATAGCAGG GCAGGGAGCAGAGAGGGCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 84, 4: 847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!