ID: 972331472_972331481

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 972331472 972331481
Species Human (GRCh38) Human (GRCh38)
Location 4:38068116-38068138 4:38068143-38068165
Sequence CCCCTCCAGTTCCAAGCAGAACA AGGAGATATCAAGGAGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178} {0: 1, 1: 0, 2: 3, 3: 42, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!