|
Left Crispr |
Right Crispr |
| Crispr ID |
972333813 |
972333818 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:38087668-38087690
|
4:38087687-38087709
|
| Sequence |
CCCGTCTCAACTGAAAATACAGA |
CAGAAATTAGCAGGGCATGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 179, 2: 9450, 3: 182980, 4: 211969} |
{0: 11, 1: 1365, 2: 36718, 3: 113208, 4: 194357} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|