ID: 972371332_972371335

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 972371332 972371335
Species Human (GRCh38) Human (GRCh38)
Location 4:38426315-38426337 4:38426347-38426369
Sequence CCATGCTCAATCTCTTTCTTGAG TCATACCAAATTTGTTCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!