ID: 972398183_972398186

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 972398183 972398186
Species Human (GRCh38) Human (GRCh38)
Location 4:38674828-38674850 4:38674841-38674863
Sequence CCTCCCTCAGGAAGGGGCAGGCA GGGGCAGGCAGTTGTCTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 336} {0: 1, 1: 0, 2: 3, 3: 18, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!