ID: 972411375_972411376

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 972411375 972411376
Species Human (GRCh38) Human (GRCh38)
Location 4:38798739-38798761 4:38798787-38798809
Sequence CCTATCAACTAAAAATTCACTTT AAGTATTAACATGAAGATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 423} {0: 1, 1: 0, 2: 3, 3: 36, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!