ID: 972416612_972416620

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 972416612 972416620
Species Human (GRCh38) Human (GRCh38)
Location 4:38847251-38847273 4:38847280-38847302
Sequence CCCCAAGGCATTCCTGTTAAAGT CAAGAATGCACACATTAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 174} {0: 1, 1: 0, 2: 2, 3: 13, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!