ID: 972420016_972420022

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 972420016 972420022
Species Human (GRCh38) Human (GRCh38)
Location 4:38878272-38878294 4:38878291-38878313
Sequence CCATTGGGCCCCCTGTGCAGCCT GCCTCAGGATGCCAACGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 238} {0: 1, 1: 0, 2: 3, 3: 13, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!