ID: 972422838_972422849

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 972422838 972422849
Species Human (GRCh38) Human (GRCh38)
Location 4:38905792-38905814 4:38905828-38905850
Sequence CCCACCCACTTCCCCTTCATCAG GCTGTCTGCCATCACCAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 389} {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!