ID: 972427172_972427181

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 972427172 972427181
Species Human (GRCh38) Human (GRCh38)
Location 4:38944507-38944529 4:38944532-38944554
Sequence CCCAGGCCACAGACCAGTACCAG CGTGGCACTGGTTAGGAACCAGG
Strand - +
Off-target summary {0: 22, 1: 60, 2: 173, 3: 346, 4: 790} {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!