ID: 972439027_972439032

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 972439027 972439032
Species Human (GRCh38) Human (GRCh38)
Location 4:39066992-39067014 4:39067014-39067036
Sequence CCAGGTTCCCCTGTTATTTATAT TCTCACATTAATATGGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 344} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!