ID: 972456079_972456089

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 972456079 972456089
Species Human (GRCh38) Human (GRCh38)
Location 4:39256751-39256773 4:39256802-39256824
Sequence CCCAGCTGTTTCCATGGAAGAGT ATCCATCCTGTTCTCCATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 208} {0: 1, 1: 1, 2: 0, 3: 45, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!