ID: 972456080_972456089

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 972456080 972456089
Species Human (GRCh38) Human (GRCh38)
Location 4:39256752-39256774 4:39256802-39256824
Sequence CCAGCTGTTTCCATGGAAGAGTC ATCCATCCTGTTCTCCATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 158} {0: 1, 1: 1, 2: 0, 3: 45, 4: 536}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!