ID: 972458859_972458871

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 972458859 972458871
Species Human (GRCh38) Human (GRCh38)
Location 4:39280484-39280506 4:39280537-39280559
Sequence CCATGTCCCTACAAAAAAATAAT CCCCGCTGCTTGGGAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 43, 2: 839, 3: 6488, 4: 25490} {0: 19, 1: 3545, 2: 100052, 3: 213765, 4: 344317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!