ID: 972470378_972470383

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 972470378 972470383
Species Human (GRCh38) Human (GRCh38)
Location 4:39398068-39398090 4:39398093-39398115
Sequence CCCTGGTTTCCATTCTTTGGGGT CTACCCAGAAGGAGAACTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 8, 3: 164, 4: 1064}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!