ID: 972543194_972543205

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 972543194 972543205
Species Human (GRCh38) Human (GRCh38)
Location 4:40056875-40056897 4:40056920-40056942
Sequence CCGTGTCTCCCCCGCGGCCGCAG GCGGGAGAGCGCAGTGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 177} {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!