|
Left Crispr |
Right Crispr |
| Crispr ID |
972545901 |
972545909 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:40080457-40080479
|
4:40080507-40080529
|
| Sequence |
CCTGCCTCTGTCTGGGACTACAG |
TTTGTATTTTAGTAAAGACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 24, 3: 146, 4: 475} |
{0: 63, 1: 2318, 2: 5523, 3: 10075, 4: 25809} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|