|
Left Crispr |
Right Crispr |
| Crispr ID |
972591131 |
972591136 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:40488147-40488169
|
4:40488187-40488209
|
| Sequence |
CCCAGCCTCTACTACAAAATTAG |
ACCTGTAATCGCCACTACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 7, 3: 117, 4: 832} |
{0: 1, 1: 46, 2: 1433, 3: 39397, 4: 169189} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|