ID: 972594303_972594307

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 972594303 972594307
Species Human (GRCh38) Human (GRCh38)
Location 4:40516558-40516580 4:40516608-40516630
Sequence CCCTCATCATTCTATTTCTCCTT ACCCAGTGCATGGTTTACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 831} {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!