|
Left Crispr |
Right Crispr |
| Crispr ID |
972597489 |
972597497 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:40542762-40542784
|
4:40542793-40542815
|
| Sequence |
CCTGAGCTCAAGTGATCCTCTCA |
TCCCTATGTGCTGGGATTGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 83, 1: 2099, 2: 15979, 3: 54563, 4: 128871} |
{0: 2, 1: 82, 2: 8827, 3: 308303, 4: 273243} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|