|
Left Crispr |
Right Crispr |
| Crispr ID |
972624106 |
972624117 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:40779314-40779336
|
4:40779367-40779389
|
| Sequence |
CCTGTCTCTGCCAGGCACTGTGG |
GCCGAGGCTGGCGGATCACAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 22, 3: 169, 4: 960} |
{0: 68, 1: 4059, 2: 29134, 3: 57220, 4: 69805} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|