ID: 972628627_972628637

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 972628627 972628637
Species Human (GRCh38) Human (GRCh38)
Location 4:40824345-40824367 4:40824367-40824389
Sequence CCTTTTGCCAGCTGTTTCCACAG GTTTTTCTGGGGGATAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 277} {0: 1, 1: 0, 2: 5, 3: 68, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!