|
Left Crispr |
Right Crispr |
Crispr ID |
972630627 |
972630635 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:40838717-40838739
|
4:40838754-40838776
|
Sequence |
CCTCAGCCTCCCAAAGTGCTGGG |
CCACCATGCCTGGCAAAAGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692} |
{0: 1, 1: 4, 2: 39, 3: 189, 4: 1060} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|