ID: 972632776_972632780

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 972632776 972632780
Species Human (GRCh38) Human (GRCh38)
Location 4:40856776-40856798 4:40856792-40856814
Sequence CCCCCATTTCATACAAGCCTCAC GCCTCACTCCTTCTTCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 169} {0: 1, 1: 0, 2: 2, 3: 41, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!