ID: 972636833_972636840

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 972636833 972636840
Species Human (GRCh38) Human (GRCh38)
Location 4:40891854-40891876 4:40891905-40891927
Sequence CCTTCTAAATCCTAGCCAAGAAA AAGACAGGTGGAGAATTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163} {0: 1, 1: 0, 2: 4, 3: 39, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!